Top » Catalog » SNPs » A7722

$19.00

A7722
[A7722]

A7722
hg38 Position: ChrY:16874092..16874092
Ancestral: C
Derived: G
Reference: Wayne Roberts (2015)
ISOGG Haplogroup: I2
Comments: Downstream of Y6644
Forward Primer: A7722_F CATCTACTTTGGTTGTTGAGTGC
Reverse Primer: A7722_R ACAAGGTGCAGTGGCTGAAG
Reviews

Customers who bought this product also purchased
A7721
A7721
A7727
A7727
A7720
A7720
A7726
A7726
A7719
A7719
A7725
A7725
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies