Honichtopf
Cart Contents
Checkout
My Account
Top
»
Catalog
»
SNPs
»
A7725
$19.00
A7725
[A7725]
hg38 Position:
ChrY:11975120..11975120
Ancestral:
G
Derived:
A
Reference:
Wayne Roberts (2015)
ISOGG Haplogroup:
I2
Comments:
Downstream of Y6644
Forward Primer:
A7725_F CAATGGATGGCCAAATGAG
Reverse Primer:
A7725_R CAGCCCACCAGGTCTTAGAG
Add to Cart
Reviews
Customers who bought this product also purchased
A7726
A7719
A7724
Y8332
A7718
A7723
Categories
Y Haplogroup Panels
(96)
Y Custom SNP Panels
(214)
SNPs
(413758)
Y-STR Beginner Panels
(3)
Y-STR Enhanced Panels->
(6)
Y-STRs
(126)
mtDNA Beginner Tests
(3)
mtDNA Enhanced Tests->
(31)
NGS Tests->
(5)
Various
(5)
Haplogroups
Please Select
A0
A00
A1a
A1b
A1b1
B
C
D
E
G
H
I1
I2
J1
J2
L
LT
M
N
O
other
Q
R1a
R1b
R2
S
T
Quick Find
Use keywords to find the product you are looking for.
Advanced Search
Reviews
Write a review on this product!
Information
Shipping & Returns
Privacy Notice
Conditions of Use
F.A.Q.
Contact Us
Impressum
Currencies
U.S. Dollar
Euro