Top » Catalog » SNPs » A7725

$19.00

A7725
[A7725]

A7725
hg38 Position: ChrY:11975120..11975120
Ancestral: G
Derived: A
Reference: Wayne Roberts (2015)
ISOGG Haplogroup: I2
Comments: Downstream of Y6644
Forward Primer: A7725_F CAATGGATGGCCAAATGAG
Reverse Primer: A7725_R CAGCCCACCAGGTCTTAGAG
Reviews

Customers who bought this product also purchased
A7726
A7726
A7719
A7719
A7724
A7724
Y8332
Y8332
A7718
A7718
A7723
A7723
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies