Top » Catalog » SNPs » A7726

$18.00

A7726
[A7726]

A7726
hg38 Position: ChrY:12701339..12701339
Ancestral: T
Derived: C
Reference: Wayne Roberts (2015)
ISOGG Haplogroup: I2
Comments: Downstream of Y6644
Forward Primer: A7726_F GGTTTCACCAGGGACTTGC
Reverse Primer: A7726_R TGCCCAGTAATGACTAAGTCCAC
Reviews

Customers who bought this product also purchased
A7721
A7721
A7727
A7727
A7720
A7720
A7725
A7725
A7719
A7719
A7724
A7724
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies