Top » Catalog » SNPs » S335

$18.00

S335
[S335]

S335
hg38 Position: ChrY:19730740..19730740
Ancestral: G
Derived: A
Reference: Jim Wilson
ISOGG Haplogroup: I1a1b3a1
Comments: Aka. L258
Forward Primer: S335_F GGCTATAGGTGATTGCCTTCC
Reverse Primer: S335_R TTCATGGAGATGTCTGTATCTGG
Reviews

Customers who bought this product also purchased
BY35406
BY35406
Y5476
Y5476
Z2045
Z2045
Y8598
Y8598
Y98743
Y98743
CTS2208
CTS2208
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies