Top » Catalog » SNPs » MZ7

$18.00

MZ7
[MZ7]

MZ7
hg38 Position: ChrY:20671092..20671092
Ancestral: C
Derived: A
Reference: E-M81 community (2015)
ISOGG Haplogroup: E1b1b1b1a
Comments: Downstream M81 > PF6794 > MZ3
Forward Primer: MZ7_F AGGAGATACAGGCAGGAGACC
Reverse Primer: MZ7_R CACTGCAGCCTGAGTTGAAG
Reviews

Customers who bought this product also purchased
M96
M96
Y22558
Y22558
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
PF2546
PF2546
M5043
M5043
L335
L335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies