Top » Catalog » SNPs » MZ7

$18.00

MZ7
[MZ7]

MZ7
hg38 Position: ChrY:20671092..20671092
Ancestral: C
Derived: A
Reference: E-M81 community (2015)
ISOGG Haplogroup: E1b1b1b1a
Comments: Downstream M81 > PF6794 > MZ3
Forward Primer: MZ7_F AGGAGATACAGGCAGGAGACC
Reverse Primer: MZ7_R CACTGCAGCCTGAGTTGAAG
Reviews

Customers who bought this product also purchased
L335
L335
MZ5
MZ5
M267
M267
BY10132
BY10132
M96
M96
Y22558
Y22558
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies