Top » Catalog » SNPs » YFS446297

$19.00

YFS446297
[YFS446297]

YFS446297
hg38 Position: ChrY:7393548..7393548
Ancestral: A
Derived: G
Reference: YFull (2015)
ISOGG Haplogroup: N1c1a1a1a1a2a4b (not listed)
Comments: Below Y10756 > PH547 > Z35246
Forward Primer: YFS446297_F CCCCCAAAAGTCAACCTAGC
Reverse Primer: YFS446297_R TGTGGCCCTAGAAATTGGTC
Reviews

Customers who bought this product also purchased
YFS446332
YFS446332
YFS446312
YFS446312
YFS446330
YFS446330
YFS446310
YFS446310
YFS446329
YFS446329
YFS446307
YFS446307
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies