Top » Catalog » SNPs » YFS446299

$18.00

YFS446299
[YFS446299]

YFS446299
hg38 Position: ChrY:8114001..8114001
Ancestral: T
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: N1c1a1a1a1a2a4b (not listed)
Comments: Below Y10756 > PH547 > Z35246
Forward Primer: YFS446299_F CTTAGCATAGCCTTAATATTGATAGTGAG
Reverse Primer: YFS446299_R TTATTACATGTTTGCCAAAACCC
Reviews

Customers who bought this product also purchased
N1c-Z35246 Panel
N1c-Z35246 Panel
YFS446318
YFS446318
YFS446332
YFS446332
YFS446312
YFS446312
YFS446330
YFS446330
YFS446310
YFS446310
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies