Top » Catalog » SNPs » YFS446307

$18.00

YFS446307
[YFS446307]

YFS446307
hg38 Position: ChrY:13166058..13166058
Ancestral: G
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: N1c1a1a1a1a2a4b (not listed)
Comments: Below Y10756 > PH547 > Z35246
Forward Primer: YFS446307_F CTTCCCCAAGCAAATAGGTG
Reverse Primer: YFS446307_R CCAATCTGAATCTCAGCCATTAC
Reviews

Customers who bought this product also purchased
YFS446312
YFS446312
YFS446330
YFS446330
YFS446310
YFS446310
YFS446329
YFS446329
YFS446299
YFS446299
YFS446320
YFS446320
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies