Top » Catalog » SNPs » YFS446330

$18.00

YFS446330
[YFS446330]

YFS446330
hg38 Position: ChrY:19637148..19637148
Ancestral: T
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: N1c1a1a1a1a2a4b (not listed)
Comments: Below Y10756 > PH547 > Z35246
Forward Primer: YFS446330_F AGGACCCCAATTTTTCCTTG
Reverse Primer: YFS446330_R ATTAGCCCAATCAGATTAAATGAAG
Reviews

Customers who bought this product also purchased
YFS446318
YFS446318
N1c-Z35246 Panel
N1c-Z35246 Panel
YFS446312
YFS446312
YFS446332
YFS446332
YFS446310
YFS446310
YFS446329
YFS446329
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies