Top » Catalog » SNPs » YFS446332

$18.00

YFS446332
[YFS446332]

YFS446332
hg38 Position: ChrY:20464245..20464245
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: N1c1a1a1a1a2a4b (not listed)
Comments: Below Y10756 > PH547 > Z35246
Forward Primer: YFS446332_F CAAGTTTTTGCAGATGGGC
Reverse Primer: YFS446332_R ACCATTGGAGTCACCCAGAC
Reviews

Customers who bought this product also purchased
YFS446330
YFS446330
YFS446310
YFS446310
YFS446329
YFS446329
YFS446307
YFS446307
YFS446320
YFS446320
YFS446299
YFS446299
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies