Top » Catalog » SNPs » FT420506

$18.00

FT420506
[FT420506]

FT420506
hg38 Position: ChrY:12281314..12281314
Ancestral: A
Derived: G
Reference: FTDNA (2021)
ISOGG Haplogroup: N
Comments: .
Forward Primer: FT420506_F TGAGGCACAAGAATCTCTTGAG
Reverse Primer: FT420506_R CGACCCAGTTGTTCTGCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies