Top » Catalog » SNPs » Y2933

$18.00

Y2933
[Y2933]

Y2933
hg38 Position: ChrY:7271977..7271977
Ancestral: T
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: Approx E1b1b1b2a1a4~ (not listed)
Comments: Downstream of E-M34 > Z841 > CTS2525/Z849, equiv with CTS1727, CTS1901
Forward Primer: Y2933_F TGTGAGTCACTGCGCTCG
Reverse Primer: Y2933_R GCTTTGAAAGGATCACAAAAATC
Reviews

Customers who bought this product also purchased
CTS4483
CTS4483
L335
L335
FT97053
FT97053
M96
M96
Y2947
Y2947
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies