Top » Catalog » SNPs » M34

$18.00

M34
[M34]

M34
hg38 Position: ChrY:19578830..19578830
Ancestral: G
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: E1b1b1b2a1a~
Comments: G10.69
Forward Primer: M34_F GAGTGACTCCCATTGTAAGGATAAC
Reverse Primer: M34_R GTCATTCCAGGGACATCCAG
Reviews

Customers who bought this product also purchased
FT97053
FT97053
Y29061
Y29061
Y103771
Y103771
Y6198
Y6198
P68
P68
Y19896
Y19896
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies