Top » Catalog » SNPs » M34

$18.00

M34
[M34]

M34
hg38 Position: ChrY:19578830..19578830
Ancestral: G
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: E1b1b1b2a1a~
Comments: G10.69
Forward Primer: M34_F GAGTGACTCCCATTGTAAGGATAAC
Reverse Primer: M34_R GTCATTCCAGGGACATCCAG
Reviews

Customers who bought this product also purchased
Y29430
Y29430
Y6174
Y6174
BY10486
BY10486
M267
M267
BY10527
BY10527
BY104490
BY104490
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies