Top » Catalog » SNPs » M34

$18.00

M34
[M34]

M34
hg38 Position: ChrY:19578830..19578830
Ancestral: G
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: E1b1b1b2a1a~
Comments: G10.69
Forward Primer: M34_F GAGTGACTCCCATTGTAAGGATAAC
Reverse Primer: M34_R GTCATTCCAGGGACATCCAG
Reviews

Customers who bought this product also purchased
FT97053
FT97053
Y29061
Y29061
Y6174
Y6174
BY10486
BY10486
M267
M267
BY10527
BY10527
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies