Top » Catalog » SNPs » M34

$18.00

M34
[M34]

M34
hg38 Position: ChrY:19578830..19578830
Ancestral: G
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: E1b1b1b2a1a~
Comments: G10.69
Forward Primer: M34_F GAGTGACTCCCATTGTAAGGATAAC
Reverse Primer: M34_R GTCATTCCAGGGACATCCAG
Reviews

Customers who bought this product also purchased
Y6172
Y6172
BY10985
BY10985
Y109622
Y109622
Z5001
Z5001
Y22762
Y22762
PF6748
PF6748
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies