Top » Catalog » SNPs » M34

$18.00

M34
[M34]

M34
hg38 Position: ChrY:19578830..19578830
Ancestral: G
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: E1b1b1b2a1a~
Comments: G10.69
Forward Primer: M34_F GAGTGACTCCCATTGTAAGGATAAC
Reverse Primer: M34_R GTCATTCCAGGGACATCCAG
Reviews

Customers who bought this product also purchased
L93
L93
P177
P177
S24051
S24051
V13
V13
Y90707
Y90707
Y5420
Y5420
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies