Top » Catalog » SNPs » M84

$18.00

M84
[M84]

M84
hg38 Position: ChrY:19736469..19736477
Ancestral: ins
Derived: del
Reference: Underhill et al.
ISOGG Haplogroup: E1b1b1b2a1a
Comments: G65278.1
Forward Primer: M84_F TCACAAACCTGGGAAAATGG
Reverse Primer: M84_R AGTGGGAAACAGCCTCAATG
Reviews

Customers who bought this product also purchased
Z18243
Z18243
M78
M78
Z827
Z827
M35
M35
CTS11051
CTS11051
M123
M123
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies