Top » Catalog » SNPs » M84

$18.00

M84
[M84]

M84
hg38 Position: ChrY:19736469..19736477
Ancestral: ins
Derived: del
Reference: Underhill et al.
ISOGG Haplogroup: E1b1b1b2a1a
Comments: G65278.1
Forward Primer: M84_F TCACAAACCTGGGAAAATGG
Reverse Primer: M84_R AGTGGGAAACAGCCTCAATG
Reviews

Customers who bought this product also purchased
Y160200
Y160200
Y18691
Y18691
Y5420
Y5420
S11387
S11387
E1b-Z834 Panel
E1b-Z834 Panel
Y14899
Y14899
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies