Top » Catalog » SNPs » YFS514147

$17.50

YFS514147
[YFS514147]

YFS514147
HG19 Position: ChrY:28761184..28761184
Ancestral: C
Derived: T
Reference: Yfull (2015)
ISOGG Haplogroup: R1a
Comments: Downstream of YP448 > YP355 > YP609 > YP4248 > YP4491
Forward Primer: YFS514147_F CGCGGTGGCTGACG
Reverse Primer: YFS514147_R ACGGAGTCTCACTCTGTCACCC
Reviews

Customers who bought this product also purchased
Wish a STR
Wish a STR
Z11827
Z11827
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies