Top » Catalog » SNPs » FGC36456

$18.00

FGC36456
[FGC36456]

FGC36456
hg38 Position: ChrY:20745229..20745229
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream BY592 > Z16245
Forward Primer: FGC36456_F AAGGCACAGAACTTGAGCCA
Reverse Primer: FGC36456_R GCAGGGACCTTCAAAAACTC
Reviews

Customers who bought this product also purchased
DF13
DF13
BY2585
BY2585
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
DF63
DF63
L21
L21
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies