Top » Catalog » SNPs » CTS4188

$18.00

CTS4188
[CTS4188]

CTS4188
hg38 Position: ChrY:13349190..13349190
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a1a2a1a2a1b3
Comments: Syn. with CTS4188; downstream CTS11796
Forward Primer: CTS4188_F GAAACTGCTGCTGGAACCAC
Reverse Primer: CTS4188_R TACTTGGGGGTGGGATTATG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
CTS4065
CTS4065
FGC39110
FGC39110
Z296
Z296
L165
L165
Z196
Z196
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies