Top » Catalog » SNPs » CTS4188

$18.00

CTS4188
[CTS4188]

CTS4188
hg38 Position: ChrY:13349190..13349190
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a1a2a1a2a1b3
Comments: Syn. with CTS4188; downstream CTS11796
Forward Primer: CTS4188_F GAAACTGCTGCTGGAACCAC
Reverse Primer: CTS4188_R TACTTGGGGGTGGGATTATG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
L165
L165
Z196
Z196
Z205
Z205
S8825
S8825
R1b-DF27 Panel
R1b-DF27 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies