Top » Catalog » SNPs » Z16254

$18.00

Z16254
[Z16254]

Z16254
hg38 Position: ChrY:15735614..15735615
Ancestral: ins
Derived: del
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a2
Comments: downstream of CTS4466
Forward Primer: Z16254_F ACAGGGATCCGTCTTTTGTG
Reverse Primer: Z16254_R GGAACGAGGGAGGGATAGC
Reviews

Customers who bought this product also purchased
A12589
A12589
A12596
A12596
A12588
A12588
A12594
A12594
A11843
A11843
Y878
Y878
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies