Top » Catalog » SNPs » A7923

$18.00

A7923
[A7923]

A7923
hg38 Position: ChrY:3106913..3106913
Ancestral: C
Derived: A
Reference: Bob Ferguson (2015)
ISOGG Haplogroup: R1b
Comments: Below DF21 > S971 > Z3004
Forward Primer: A7923_F AAATTTCAGCTTTCATTGAGGAG
Reverse Primer: A7923_R AGAGCTGGAATCCTGGTGAG
Reviews

Customers who bought this product also purchased
Z3004
Z3004
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
FGC41929
FGC41929
DF21
DF21
S971
S971
FGC41930
FGC41930
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L829
$18.00
Haplogroup Info
Other products
Currencies