Top » Catalog » SNPs » A7923

$18.00

A7923
[A7923]

A7923
hg38 Position: ChrY:3106913..3106913
Ancestral: C
Derived: A
Reference: Bob Ferguson (2015)
ISOGG Haplogroup: R1b
Comments: Below DF21 > S971 > Z3004
Forward Primer: A7923_F AAATTTCAGCTTTCATTGAGGAG
Reverse Primer: A7923_R AGAGCTGGAATCCTGGTGAG
Reviews

Customers who bought this product also purchased
DF5
DF5
S953
S953
Z39589
Z39589
FGC3213
FGC3213
Z16274
Z16274
DF13
DF13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies