Top » Catalog » SNPs » A7923

$18.00

A7923
[A7923]

A7923
hg38 Position: ChrY:3106913..3106913
Ancestral: C
Derived: A
Reference: Bob Ferguson (2015)
ISOGG Haplogroup: R1b
Comments: Below DF21 > S971 > Z3004
Forward Primer: A7923_F AAATTTCAGCTTTCATTGAGGAG
Reverse Primer: A7923_R AGAGCTGGAATCCTGGTGAG
Reviews

Customers who bought this product also purchased
Z253
Z253
S5488
S5488
A14079
A14079
DF49
DF49
DF5
DF5
S953
S953
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies