Top » Catalog » SNPs » CTS1977

$18.00

CTS1977
[CTS1977]

CTS1977
hg38 Position: ChrY:12019567..12019567
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a2a1b2a1
Comments: Syn. with CTS1858; downstream CTS2392 Z76
Forward Primer: CTS1977_F TCACGTGAACATGGAACAGAAC
Reverse Primer: CTS1977_R GCTAACAGCTGAAGGAATAAAAGG
Reviews

Customers who bought this product also purchased
Y16963
Y16963
P38
P38
Y6644
Y6644
S2361
S2361
L801
L801
M9
M9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies