Top » Catalog » SNPs » CTS1977

$18.00

CTS1977
[CTS1977]

CTS1977
hg38 Position: ChrY:12019567..12019567
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a2a1b2a1
Comments: Syn. with CTS1858; downstream CTS2392 Z76
Forward Primer: CTS1977_F TCACGTGAACATGGAACAGAAC
Reverse Primer: CTS1977_R GCTAACAGCTGAAGGAATAAAAGG
Reviews

Customers who bought this product also purchased
Y5282
Y5282
HVR2
HVR2
L1317
L1317
M223
M223
Z161
Z161
HVR1
HVR1
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies