Top » Catalog » SNPs » CTS1977

$18.00

CTS1977
[CTS1977]

CTS1977
hg38 Position: ChrY:12019567..12019567
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a2a1b2a1
Comments: Syn. with CTS1858; downstream CTS2392 Z76
Forward Primer: CTS1977_F TCACGTGAACATGGAACAGAAC
Reverse Primer: CTS1977_R GCTAACAGCTGAAGGAATAAAAGG
Reviews

Customers who bought this product also purchased
HVR1
HVR1
Y110378
Y110378
Y6639
Y6639
M438
M438
CTS6433
CTS6433
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies