Top » Catalog » SNPs » MZ11

$18.00

MZ11
[MZ11]

MZ11
hg38 Position: ChrY:21601030..21601030
Ancestral: T
Derived: C
Reference: E-M81 community (2015)
ISOGG Haplogroup: E1b1b1b1a
Comments: Downstream of M5043
Forward Primer: MZ11_F GCAGATGAGGTGGAGACAGTC
Reverse Primer: MZ11_R CAGGCCACTGTGTCTGGTG
Reviews

Customers who bought this product also purchased
MZ39
MZ39
V38
V38
V13
V13
E Superclade Panel
E Superclade Panel
Y158793
Y158793
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies