Top » Catalog » SNPs » Y5282

$18.00

Y5282
[Y5282]

Y5282
hg38 Position: ChrY:8114574..8114574
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: I2a2a1b2a1a
Comments: Below L801
Forward Primer: Y5282_F GTATTCCAGAAATATTCCATAAACCAC
Reverse Primer: Y5282_R TTCCTTTGCTTCCCCAGTAG
Reviews

Customers who bought this product also purchased
P38
P38
Y6644
Y6644
S2361
S2361
CTS1977
CTS1977
M9
M9
Y6647
Y6647
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies