Top » Catalog » SNPs » Y5282

$18.00

Y5282
[Y5282]

Y5282
hg38 Position: ChrY:8114574..8114574
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: I2a2a1b2a1a
Comments: Below L801
Forward Primer: Y5282_F GTATTCCAGAAATATTCCATAAACCAC
Reverse Primer: Y5282_R TTCCTTTGCTTCCCCAGTAG
Reviews

Customers who bought this product also purchased
M438
M438
Y6639
Y6639
CTS6433
CTS6433
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
CTS10743
CTS10743
M253
M253
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies