Top » Catalog » SNPs » Y5282

$18.00

Y5282
[Y5282]

Y5282
hg38 Position: ChrY:8114574..8114574
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: I2a2a1b2a1a
Comments: Below L801
Forward Primer: Y5282_F GTATTCCAGAAATATTCCATAAACCAC
Reverse Primer: Y5282_R TTCCTTTGCTTCCCCAGTAG
Reviews

Customers who bought this product also purchased
Z161
Z161
HVR1
HVR1
Y110378
Y110378
M438
M438
Y6639
Y6639
CTS6433
CTS6433
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies