Top » Catalog » SNPs » A417

$18.00

A417
[A417]

A417
hg38 Position: ChrY:8978923..8978923
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: I2a1a2a1a1
Comments: Below L233 > Y4252
Forward Primer: A417_F GCACTTCAGCCTGAGCCAC
Reverse Primer: A417_R CAAATTGGAATACTTACAGGTGCC
Reviews

Customers who bought this product also purchased
A19485
A19485
A19384
A19384
L160
L160
Y4200
Y4200
Y33761
Y33761
L233
L233
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies