Top » Catalog » SNPs » A417

$18.00

A417
[A417]

A417
hg38 Position: ChrY:8978923..8978923
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: I2a1a2a1a1
Comments: Below L233 > Y4252
Forward Primer: A417_F GCACTTCAGCCTGAGCCAC
Reverse Primer: A417_R CAAATTGGAATACTTACAGGTGCC
Reviews

Customers who bought this product also purchased
Y33761
Y33761
Y4200
Y4200
L233
L233
FGC56815
FGC56815
CTS814
CTS814
I2a-CTS595 Panel
I2a-CTS595 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies