Top » Catalog » SNPs » A417

$18.00

A417
[A417]

A417
hg38 Position: ChrY:8978923..8978923
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: I2a1a2a1a1
Comments: Below L233 > Y4252
Forward Primer: A417_F GCACTTCAGCCTGAGCCAC
Reverse Primer: A417_R CAAATTGGAATACTTACAGGTGCC
Reviews

Customers who bought this product also purchased
M223
M223
I2 Superclade Panel
I2 Superclade Panel
Y54081
Y54081
Y138217
Y138217
A19385
A19385
A19485
A19485
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies