Top » Catalog » SNPs » FGC39788

$18.00

FGC39788
[FGC39788]

FGC39788
hg38 Position: ChrY:13129612..13129612
Ancestral: C
Derived: G
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC39788_F TCTAGGCATGGTCAGTGCTC
Reverse Primer: FGC39788_R CTGGCATGCTAGGGAAAGAG
Reviews

Customers who bought this product also purchased
R1b-S1051 Henry Panel
R1b-S1051 Henry Panel
FGC33265
FGC33265
FGC23331
FGC23331
FGC23336
FGC23336
FGC39789
FGC39789
FGC23330
FGC23330
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies