Top » Catalog » SNPs » FGC39788

$18.00

FGC39788
[FGC39788]

FGC39788
hg38 Position: ChrY:13129612..13129612
Ancestral: C
Derived: G
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC39788_F TCTAGGCATGGTCAGTGCTC
Reverse Primer: FGC39788_R CTGGCATGCTAGGGAAAGAG
Reviews

Customers who bought this product also purchased
FGC23330
FGC23330
FGC23335
FGC23335
FGC39790
FGC39790
FGC19434
FGC19434
FGC23334
FGC23334
FGC23339
FGC23339
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies