Top » Catalog » SNPs » FGC39789

$18.00

FGC39789
[FGC39789]

FGC39789
hg38 Position: ChrY:14708055..14708055
Ancestral: C
Derived: A
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of S1051
Forward Primer: FGC39789_F GCACAGGAATATGTCAGGAAGC
Reverse Primer: FGC39789_R TCAAGTGTGCAAATGCAATG
Reviews

Customers who bought this product also purchased
FGC23338
FGC23338
FGC17906
FGC17906
FGC33267
FGC33267
FGC23332
FGC23332
FGC23337
FGC23337
R1b-S1051 Henry Panel
R1b-S1051 Henry Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies