Top » Catalog » SNPs » FGC39789

$18.00

FGC39789
[FGC39789]

FGC39789
hg38 Position: ChrY:14708055..14708055
Ancestral: C
Derived: A
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of S1051
Forward Primer: FGC39789_F GCACAGGAATATGTCAGGAAGC
Reverse Primer: FGC39789_R TCAAGTGTGCAAATGCAATG
Reviews

Customers who bought this product also purchased
FGC19432
FGC19432
FGC23333
FGC23333
FGC23338
FGC23338
FGC33267
FGC33267
FGC17906
FGC17906
FGC23332
FGC23332
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies