Top » Catalog » SNPs » FGC39790

$18.00

FGC39790
[FGC39790]

FGC39790
hg38 Position: ChrY:14898123..14898123
Ancestral: T
Derived: C
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of S1051
Forward Primer: FGC39790_F TGGGCAACAGAGCTAAATCC
Reverse Primer: FGC39790_R CATTTAACCTGGGAAAAATAAGAGC
Reviews

Customers who bought this product also purchased
FGC23333
FGC23333
FGC23338
FGC23338
FGC17906
FGC17906
FGC33267
FGC33267
FGC23332
FGC23332
FGC23337
FGC23337
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies