Top » Catalog » SNPs » FGC39790

$18.00

FGC39790
[FGC39790]

FGC39790
hg38 Position: ChrY:14898123..14898123
Ancestral: T
Derived: C
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of S1051
Forward Primer: FGC39790_F TGGGCAACAGAGCTAAATCC
Reverse Primer: FGC39790_R CATTTAACCTGGGAAAAATAAGAGC
Reviews

Customers who bought this product also purchased
FGC23331
FGC23331
FGC23336
FGC23336
FGC39789
FGC39789
FGC23330
FGC23330
FGC23335
FGC23335
FGC39788
FGC39788
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies