Top » Catalog » SNPs » FGC39790

$18.00

FGC39790
[FGC39790]

FGC39790
hg38 Position: ChrY:14898123..14898123
Ancestral: T
Derived: C
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of S1051
Forward Primer: FGC39790_F TGGGCAACAGAGCTAAATCC
Reverse Primer: FGC39790_R CATTTAACCTGGGAAAAATAAGAGC
Reviews

Customers who bought this product also purchased
FGC17906
FGC17906
FGC33267
FGC33267
FGC23332
FGC23332
FGC23337
FGC23337
R1b-S1051 Henry Panel
R1b-S1051 Henry Panel
FGC33265
FGC33265
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies