Top » Catalog » SNPs » FGC39790

$18.00

FGC39790
[FGC39790]

FGC39790
hg38 Position: ChrY:14898123..14898123
Ancestral: T
Derived: C
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of S1051
Forward Primer: FGC39790_F TGGGCAACAGAGCTAAATCC
Reverse Primer: FGC39790_R CATTTAACCTGGGAAAAATAAGAGC
Reviews

Customers who bought this product also purchased
FGC19434
FGC19434
FGC23334
FGC23334
FGC23339
FGC23339
FGC19432
FGC19432
FGC23333
FGC23333
FGC23338
FGC23338
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies