Top » Catalog » SNPs » FGC37843

$18.00

FGC37843
[FGC37843]

FGC37843
hg38 Position: ChrY:19531660..19531660
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC6 > FGC37534
Forward Primer: FGC37843_F GGGTTAGATCTCCCACAGAGG
Reverse Primer: FGC37843_R AAAGTATTCATTTCCTCTAGGTTTTCC
Reviews

Customers who bought this product also purchased
Z19217
Z19217
FGC37851
FGC37851
FGC37850
FGC37850
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies