Top » Catalog » SNPs » Z282

$18.00

Z282
[Z282]

Z282
hg38 Position: ChrY:13476521..13476521
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b1a
Comments: Below Z283. Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z282_F GCAAACAAAACGCATATAACG
Reverse Primer: Z282_R GTGAACCCGCATATCAAACC
Reviews

Customers who bought this product also purchased
YP4622
YP4622
YP1046
YP1046
YP4132
YP4132
Y38317
Y38317
Z2103
Z2103
CTS9219
CTS9219
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies