Top » Catalog » SNPs » Z282

$18.00

Z282
[Z282]

Z282
hg38 Position: ChrY:13476521..13476521
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b1a
Comments: Below Z283. Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z282_F GCAAACAAAACGCATATAACG
Reverse Primer: Z282_R GTGAACCCGCATATCAAACC
Reviews

Customers who bought this product also purchased
DYS449
DYS449
Y166625
Y166625
DYS570
DYS570
YP5950
YP5950
A19325
A19325
DYS576
DYS576
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies