Top » Catalog » SNPs » Z282

$18.00

Z282
[Z282]

Z282
hg38 Position: ChrY:13476521..13476521
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b1a
Comments: Below Z283. Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z282_F GCAAACAAAACGCATATAACG
Reverse Primer: Z282_R GTGAACCCGCATATCAAACC
Reviews

Customers who bought this product also purchased
Y35606
Y35606
Y134167
Y134167
PF5327
PF5327
FT9334
FT9334
YP310
YP310
ZS9035
ZS9035
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies