Top » Catalog » SNPs » A419

$18.00

A419
[A419]

A419
hg38 Position: ChrY:8202948..8202948
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A419_F CAATGTTACCCTTTCCTACAGCT
Reverse Primer: A419_R TGAATTCCCAAGAGCTGAGC
Reviews

Customers who bought this product also purchased
A682
A682
A712
A712
A422
A422
CTS8704
CTS8704
A421
A421
A426
A426
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies