Top » Catalog » SNPs » A420

$18.00

A420
[A420]

A420
hg38 Position: ChrY:14919967..14919967
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A420_F AACCATGGGTGTCGTTAACC
Reverse Primer: A420_R AGGTGCCTGGAAATTACCG
Reviews

Customers who bought this product also purchased
A712
A712
A682
A682
A425
A425
Z16840
Z16840
A418
A418
A424
A424
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies